Top » Catalog » SNPs » A8549

$18.00

A8549
[A8549]

A8549
hg38 Position: ChrY:11868806..11868806
Ancestral: C
Derived: A
Reference: Alex Buchanan (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: Below DF27
Forward Primer: A8549_F AAGAGTCAAATCCAAGCAGGAG
Reverse Primer: A8549_R CCAAATATTTTTAATCCAGGAGGAG
Reviews (1)

Customers who bought this product also purchased
A8550
A8550
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x J2a-M67 Panel
1 x A8549
$106.00
Haplogroup Info
Other products
Currencies