Top » Catalog » SNPs » A494

$18.00

A494
[A494]

A494
hg38 Position: ChrY:15833239..15833239
Ancestral: C
Derived: A
Reference: Dennis Wright (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1f5
Comments: Z253
Forward Primer: A494_F TCATCAACTTCAAGTAATTCAGAAGG
Reverse Primer: A494_R TTCCATAGCTCTTTGAGAGTGG
Reviews

Customers who bought this product also purchased
Z29749
Z29749
Z2188
Z2188
BY414
BY414
FGC17244
FGC17244
FGC5494
FGC5494
PH2769
PH2769
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies