Top » Catalog » SNPs » A8555

$18.00

A8555
[A8555]

A8555
hg38 Position: ChrY:7558719..7558719
Ancestral: G
Derived: C
Reference: E-V13 community (2015)
ISOGG Haplogroup: E1b1 (not listed)
Comments: Downstream A7136
Forward Primer: A8555_F CAAACACAATCAGATACATACATAGGTATC
Reverse Primer: A8555_R TGCCTGTGTGTCTCTATGTGC
Reviews

Customers who bought this product also purchased
Y129143
Y129143
Y128213
Y128213
A7136
A7136
Y83041
Y83041
Z5018
Z5018
S2972
S2972
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies