Top » Catalog » SNPs » Y18100

$18.00

Y18100
[Y18100]

Y18100
hg38 Position: ChrY:19500286..19500286
Ancestral: G
Derived: C
Reference: YFull (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: Below U106 > Z156
Forward Primer: Y18100_F TGAAGGTGGGGAGTACAAGC
Reverse Primer: Y18100_R GAAACACAGTCAGGGTGTGC
Reviews

Customers who bought this product also purchased
Z18
Z18
S5520
S5520
S5556
S5556
L48
L48
S1911
S1911
A9580
A9580
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies