Top » Catalog » SNPs » L1259

$18.00

L1259
[L1259]

L1259
hg38 Position: ChrY:13503460..13503460
Ancestral: C
Derived: G
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: G2a2
Comments: Found in a hg G-U1 WTY participant
Forward Primer: L1259_F GCACTCTCCAGATTCAAGCTTC
Reverse Primer: L1259_R GAAGCTGGAATGGCAAGTG
Reviews

Customers who bought this product also purchased
M9
M9
L497
L497
M168
M168
M89
M89
M406
M406
*TOP* - Top-Level Orientation Panel
*TOP* - Top-Level Orientation Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies