Top » Catalog » SNPs » L1259

$18.00

L1259
[L1259]

L1259
hg38 Position: ChrY:13503460..13503460
Ancestral: C
Derived: G
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: G2a2
Comments: Found in a hg G-U1 WTY participant
Forward Primer: L1259_F GCACTCTCCAGATTCAAGCTTC
Reverse Primer: L1259_R GAAGCTGGAATGGCAAGTG
Reviews

Customers who bought this product also purchased
Y32607
Y32607
CTS342
CTS342
FGC21495
FGC21495
U1
U1
L1264
L1264
Z44144
Z44144
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies