Top » Catalog » SNPs » L1259

$18.00

L1259
[L1259]

L1259
hg38 Position: ChrY:13503460..13503460
Ancestral: C
Derived: G
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: G2a2
Comments: Found in a hg G-U1 WTY participant
Forward Primer: L1259_F GCACTCTCCAGATTCAAGCTTC
Reverse Primer: L1259_R GAAGCTGGAATGGCAAGTG
Reviews

Customers who bought this product also purchased
Z35447
Z35447
Z17774
Z17774
FGC750
FGC750
Z31470
Z31470
FGC715
FGC715
Z31475
Z31475
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies