Top » Catalog » SNPs » L1259

$18.00

L1259
[L1259]

L1259
hg38 Position: ChrY:13503460..13503460
Ancestral: C
Derived: G
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: G2a2
Comments: Found in a hg G-U1 WTY participant
Forward Primer: L1259_F GCACTCTCCAGATTCAAGCTTC
Reverse Primer: L1259_R GAAGCTGGAATGGCAAGTG
Reviews

Customers who bought this product also purchased
L31
L31
S11726
S11726
Z6343
Z6343
PF3293
PF3293
Z6354
Z6354
M3355
M3355
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies