Top » Catalog » SNPs » A8613

$18.00

A8613
[A8613]

A8613
hg38 Position: ChrY:12913822..12913822
Ancestral: A
Derived: G
Reference: Dennis Waters (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream L93
Forward Primer: A8613_F CAGAAATTGCGACAGATACAGC
Reverse Primer: A8613_R TTCATCCCAAGGATCCAAAG
Reviews

Customers who bought this product also purchased
FGC12365
FGC12365
R1b Inman Segregation Panel
R1b Inman Segregation Panel
S10582
S10582
FGC12359
FGC12359
S18249
S18249
A8615
A8615
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies