Top » Catalog » SNPs » A8613

$18.00

A8613
[A8613]

A8613
hg38 Position: ChrY:12913822..12913822
Ancestral: A
Derived: G
Reference: Dennis Waters (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream L93
Forward Primer: A8613_F CAGAAATTGCGACAGATACAGC
Reverse Primer: A8613_R TTCATCCCAAGGATCCAAAG
Reviews

Customers who bought this product also purchased
A8614
A8614
A8619
A8619
FGC12366
FGC12366
L93
L93
A8616
A8616
FGC12360
FGC12360
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies