Top » Catalog » SNPs » A8614

$18.00

A8614
[A8614]

A8614
hg38 Position: ChrY:14384891..14384891
Ancestral: G
Derived: T
Reference: Dennis Waters (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream L93
Forward Primer: A8614_F CACATATGTGTGTGTGCATGC
Reverse Primer: A8614_R TTTAATTGTGAAGTTAATACATAGATTATCTTCAG
Reviews

Customers who bought this product also purchased
S16265
S16265
S10185
S10185
FGC12355
FGC12355
S17693
S17693
FGC12364
FGC12364
FGC12374
FGC12374
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies