Top » Catalog » SNPs » A8614

$18.00

A8614
[A8614]

A8614
hg38 Position: ChrY:14384891..14384891
Ancestral: G
Derived: T
Reference: Dennis Waters (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream L93
Forward Primer: A8614_F CACATATGTGTGTGTGCATGC
Reverse Primer: A8614_R TTTAATTGTGAAGTTAATACATAGATTATCTTCAG
Reviews

Customers who bought this product also purchased
FGC12366
FGC12366
L93
L93
A8616
A8616
FGC12360
FGC12360
A8618
A8618
FGC12365
FGC12365
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies