Top » Catalog » SNPs » A8617

$18.00

A8617
[A8617]

A8617
hg38 Position: ChrY:8782863..8782863
Ancestral: G
Derived: C
Reference: Dennis Waters (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream L93
Forward Primer: A8617_F ACCCCTTATCATCACAGTAAAAGTG
Reverse Primer: A8617_R TCAGTGGTTTCTTACAGCCCTC
Reviews

Customers who bought this product also purchased
FGC12365
FGC12365
L93
L93
S10582
S10582
FGC12360
FGC12360
A8618
A8618
A8615
A8615
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies