Top » Catalog » SNPs » A8618

$18.00

A8618
[A8618]

A8618
hg38 Position: ChrY:15364720..15364720
Ancestral: G
Derived: T
Reference: Dennis Waters (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream L93
Forward Primer: A8618_F ACCTGTCTTCCCGGACG
Reverse Primer: A8618_R CCTCCAGACCTTATTCTCCTGTC
Reviews

Customers who bought this product also purchased
A8613
A8613
A8619
A8619
FGC12365
FGC12365
L93
L93
S10582
S10582
FGC12360
FGC12360
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies