Top » Catalog » SNPs » A8618

$18.00

A8618
[A8618]

A8618
hg38 Position: ChrY:15364720..15364720
Ancestral: G
Derived: T
Reference: Dennis Waters (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream L93
Forward Primer: A8618_F ACCTGTCTTCCCGGACG
Reverse Primer: A8618_R CCTCCAGACCTTATTCTCCTGTC
Reviews

Customers who bought this product also purchased
FGC12363
FGC12363
FGC12367
FGC12367
FGC12354
FGC12354
A8617
A8617
A8614
A8614
S24868
S24868
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies