Top » Catalog » SNPs » A8618

$18.00

A8618
[A8618]

A8618
hg38 Position: ChrY:15364720..15364720
Ancestral: G
Derived: T
Reference: Dennis Waters (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream L93
Forward Primer: A8618_F ACCTGTCTTCCCGGACG
Reverse Primer: A8618_R CCTCCAGACCTTATTCTCCTGTC
Reviews

Customers who bought this product also purchased
A8615
A8615
R1b Inman Segregation Panel
R1b Inman Segregation Panel
S10185
S10185
FGC12359
FGC12359
S17693
S17693
FGC12364
FGC12364
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies