Top » Catalog » SNPs » FGC12366

$18.00

FGC12366
[FGC12366]

FGC12366
hg38 Position: ChrY:17048671..17048671
Ancestral: A
Derived: C
Reference: Full Genomes (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream L93
Forward Primer: FGC12366_F CCAATACATAAAACAACACTGATTAACTTC
Reverse Primer: FGC12366_R GGAATTCTAGAATATCAGCTAGTGTTG
Reviews

Customers who bought this product also purchased
FGC12367
FGC12367
FGC12352
FGC12352
A8617
A8617
A8613
A8613
A8619
A8619
FGC12365
FGC12365
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies