Top » Catalog » SNPs » FGC12366

$18.00

FGC12366
[FGC12366]

FGC12366
hg38 Position: ChrY:17048671..17048671
Ancestral: A
Derived: C
Reference: Full Genomes (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream L93
Forward Primer: FGC12366_F CCAATACATAAAACAACACTGATTAACTTC
Reverse Primer: FGC12366_R GGAATTCTAGAATATCAGCTAGTGTTG
Reviews

Customers who bought this product also purchased
FGC12364
FGC12364
S16265
S16265
S10185
S10185
FGC12355
FGC12355
S17693
S17693
FGC12363
FGC12363
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies