Top » Catalog » SNPs » FGC12366

$18.00

FGC12366
[FGC12366]

FGC12366
hg38 Position: ChrY:17048671..17048671
Ancestral: A
Derived: C
Reference: Full Genomes (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream L93
Forward Primer: FGC12366_F CCAATACATAAAACAACACTGATTAACTTC
Reverse Primer: FGC12366_R GGAATTCTAGAATATCAGCTAGTGTTG
Reviews

Customers who bought this product also purchased
L93
L93
A8616
A8616
FGC12360
FGC12360
A8618
A8618
A8615
A8615
R1b Inman Segregation Panel
R1b Inman Segregation Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies