Top » Catalog » SNPs » FGC12367

$18.00

FGC12367
[FGC12367]

FGC12367
hg38 Position: ChrY:19279403..19279403
Ancestral: A
Derived: T
Reference: Full Genomes (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream L93
Forward Primer: FGC12367_F TCAACCCTGGGTACGAAAAG
Reverse Primer: FGC12367_R GGAGCAAATTACACTGAGCAAC
Reviews

Customers who bought this product also purchased
FGC12354
FGC12354
S16857
S16857
A8614
A8614
S24868
S24868
FGC12366
FGC12366
FGC12352
FGC12352
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies