Top » Catalog » SNPs » FGC12374

$18.00

FGC12374
[FGC12374]

FGC12374
hg38 Position: ChrY:22212371..22212371
Ancestral: A
Derived: T
Reference: Full Genomes (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream L93
Forward Primer: FGC12374_F CTTTGCATTGTGAAAGACATGG
Reverse Primer: FGC12374_R CAGTAAATTAATGTTCTGTACATGAAATAAAC
Reviews

Customers who bought this product also purchased
A8613
A8613
A8619
A8619
FGC12365
FGC12365
L93
L93
A8616
A8616
FGC12360
FGC12360
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies