Top » Catalog » SNPs » FGC12374

$18.00

FGC12374
[FGC12374]

FGC12374
hg38 Position: ChrY:22212371..22212371
Ancestral: A
Derived: T
Reference: Full Genomes (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream L93
Forward Primer: FGC12374_F CTTTGCATTGTGAAAGACATGG
Reverse Primer: FGC12374_R CAGTAAATTAATGTTCTGTACATGAAATAAAC
Reviews

Customers who bought this product also purchased
A8615
A8615
R1b Inman Segregation Panel
R1b Inman Segregation Panel
S10582
S10582
FGC12359
FGC12359
S18249
S18249
FGC12364
FGC12364
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies