Top » Catalog » SNPs » FGC12374

$18.00

FGC12374
[FGC12374]

FGC12374
hg38 Position: ChrY:22212371..22212371
Ancestral: A
Derived: T
Reference: Full Genomes (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream L93
Forward Primer: FGC12374_F CTTTGCATTGTGAAAGACATGG
Reverse Primer: FGC12374_R CAGTAAATTAATGTTCTGTACATGAAATAAAC
Reviews

Customers who bought this product also purchased
FGC12355
FGC12355
S17693
S17693
FGC12363
FGC12363
FGC12367
FGC12367
FGC12354
FGC12354
S16857
S16857
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies