Top » Catalog » SNPs » FGC34530

$18.00

FGC34530
[FGC34530]

FGC34530
hg38 Position: ChrY:7138207..7138207
Ancestral: C
Derived: A
Reference: Full Genomes Corp. (2015)
ISOGG Haplogroup: J1a (not listed)
Comments: Below FGC1713 > ZS5804
Forward Primer: FGC34530v2_F CAACCAAAAAGAGTCCAGGATG
Reverse Primer: FGC34530v2_R AATTTATTGAGAGTTTTTAGCATGAACA
Reviews

Customers who bought this product also purchased
Wish a SNP
Wish a SNP
Y16746
Y16746
A27137
A27137
J1-FGC1713 Panel
J1-FGC1713 Panel
A16980
A16980
A27224
A27224
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies