Top » Catalog » SNPs » S10582

$19.00

S10582
[S10582]

S10582
hg38 Position: ChrY:7865221..7865221
Ancestral: G
Derived: T
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream U106
Forward Primer: S10582_F TGGGGTTTATGTCTTGAGAGG
Reverse Primer: S10582_R AACCATGAGGCCAAGAACAC
Reviews

Customers who bought this product also purchased
FGC12363
FGC12363
FGC12367
FGC12367
FGC12354
FGC12354
S16857
S16857
A8614
A8614
S24868
S24868
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies