Top » Catalog » SNPs » S16857

$18.00

S16857
[S16857]

S16857
hg38 Position: ChrY:13082065..13082065
Ancestral: A
Derived: G
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream L93
Forward Primer: S16857v2_F GGGTTTCACCGTGTTACCG
Reverse Primer: S16857v2_R CTGCTTAGGTCTCAGAAAGGGTC
Reviews

Customers who bought this product also purchased
FGC12355
FGC12355
S17693
S17693
FGC12363
FGC12363
FGC12367
FGC12367
FGC12354
FGC12354
A8617
A8617
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies