Top » Catalog » SNPs » S17693

$18.00

S17693
[S17693]

S17693
hg38 Position: ChrY:13762855..13762855
Ancestral: A
Derived: C
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream L93
Forward Primer: S17693_F TTGGCACTTTGAACGTTTTG
Reverse Primer: S17693_R GTCATGCCTGCCAGAATATC
Reviews

Customers who bought this product also purchased
R1b Inman Segregation Panel
R1b Inman Segregation Panel
S10185
S10185
FGC12359
FGC12359
S18249
S18249
FGC12364
FGC12364
S16265
S16265
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies