Top » Catalog » SNPs » S17693

$18.00

S17693
[S17693]

S17693
hg38 Position: ChrY:13762855..13762855
Ancestral: A
Derived: C
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream L93
Forward Primer: S17693_F TTGGCACTTTGAACGTTTTG
Reverse Primer: S17693_R GTCATGCCTGCCAGAATATC
Reviews

Customers who bought this product also purchased
FGC12360
FGC12360
A8618
A8618
A8615
A8615
R1b Inman Segregation Panel
R1b Inman Segregation Panel
S10185
S10185
FGC12359
FGC12359
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies