Top » Catalog » SNPs » S18249

$18.00

S18249
[S18249]

S18249
hg38 Position: ChrY:14289954..14289954
Ancestral: A
Derived: C
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream L93
Forward Primer: S18249_F AGAATCACTTGCAAGCTCACTG
Reverse Primer: S18249_R TAGAAACTTTATTGCCATAGATTGG
Reviews

Customers who bought this product also purchased
FGC12363
FGC12363
FGC12367
FGC12367
FGC12354
FGC12354
A8617
A8617
A8614
A8614
S24868
S24868
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies