Top » Catalog » SNPs » FGC29470

$18.00

FGC29470
[FGC29470]

FGC29470
hg38 Position: ChrY:20918804..20918804
Ancestral: C
Derived: T
Reference: Full Genomes Corp. (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: Below DF90
Forward Primer: FGC29470_F TAAATATACTAATCCTCTCTGACTGAGCTTC
Reverse Primer: FGC29470_R TGCCTTTGTCCTCCAGATATTG
Reviews

Customers who bought this product also purchased
DNA Sample Kit
DNA Sample Kit
FGC6204
FGC6204
FGC29433
FGC29433
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies