Top » Catalog » SNPs » FGC12354

$18.00

FGC12354
[FGC12354]

FGC12354
hg38 Position: ChrY:7852906..7852906
Ancestral: A
Derived: G
Reference: Full Genomes (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream L93
Forward Primer: FGC12354_F CAAATGCTGAGGAAATCTTTTAC
Reverse Primer: FGC12354_R GGACTACAGGCACACACTGC
Reviews

Customers who bought this product also purchased
FGC12355
FGC12355
S16857
S16857
FGC12363
FGC12363
S24868
S24868
FGC12367
FGC12367
FGC12352
FGC12352
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies