Top » Catalog » SNPs » A8740

$18.00

A8740
[A8740]

A8740
hg38 Position: ChrY:13786417..13786417
Ancestral: A
Derived: G
Reference: Zdenko Markovic (2015)
ISOGG Haplogroup: I2a1b3a (not listed)
Comments: Below A356/Z16983
Forward Primer: A8740_F TGTGGAATGCAGAAATTCTAATG
Reverse Primer: A8740_R CCCCACACGGATTTTTCTTC
Reviews

Customers who bought this product also purchased
BY170650
BY170650
Y5595
Y5595
Y134603
Y134603
A16681
A16681
Y3118
Y3118
A2329
A2329
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies