Top » Catalog » SNPs » A8740

$18.00

A8740
[A8740]

A8740
hg38 Position: ChrY:13786417..13786417
Ancestral: A
Derived: G
Reference: Zdenko Markovic (2015)
ISOGG Haplogroup: I2a1b3a (not listed)
Comments: Below A356/Z16983
Forward Primer: A8740_F TGTGGAATGCAGAAATTCTAATG
Reverse Primer: A8740_R CCCCACACGGATTTTTCTTC
Reviews

Customers who bought this product also purchased
BY170650
BY170650
A5874
A5874
A12505
A12505
A11115
A11115
Y4882
Y4882
Y56203
Y56203
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies