Top » Catalog » SNPs » F3369

$18.00

F3369
[F3369]

F3369
hg38 Position: ChrY:20753612..20753612
Ancestral: T
Derived: A
Reference: Yan Shi (2011)
ISOGG Haplogroup: J2a1 (not listed)
Comments: Below L25 > Z7700 > FGC9942 > FGC9961
Forward Primer: F3369_F TCCATGCAGAGTCAGCTGTG
Reverse Primer: F3369_R TGCTCCTTAAAACAACTCCACC
Reviews

Customers who bought this product also purchased
FGC9961
FGC9961
PF5088
PF5088
PF5197
PF5197
FGC9883
FGC9883
L26
L26
L24
L24
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies