Top » Catalog » SNPs » F3369

$18.00

F3369
[F3369]

F3369
hg38 Position: ChrY:20753612..20753612
Ancestral: T
Derived: A
Reference: Yan Shi (2011)
ISOGG Haplogroup: J2a1 (not listed)
Comments: Below L25 > Z7700 > FGC9942 > FGC9961
Forward Primer: F3369_F TCCATGCAGAGTCAGCTGTG
Reverse Primer: F3369_R TGCTCCTTAAAACAACTCCACC
Reviews

Customers who bought this product also purchased
PF5197
PF5197
FGC9883
FGC9883
L26
L26
L24
L24
PF5401
PF5401
J2-M172 Superclade Panel
J2-M172 Superclade Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies