Top » Catalog » SNPs » FGC9927

$18.00

FGC9927
[FGC9927]

FGC9927
hg38 Position: ChrY:13689551..13689551
Ancestral: C
Derived: A
Reference: Full Genomes (2014)
ISOGG Haplogroup: J2a1 (not listed)
Comments: Below L25 > Z7700 > FGC9942 > FGC9961
Forward Primer: FGC9927_F CATGTAAAATAAAGTTCCACCATTTC
Reverse Primer: FGC9927_R GGCTGAGGCGGACAATTG
Reviews

Customers who bought this product also purchased
F4049
F4049
F4193
F4193
Z38951
Z38951
Y213653
Y213653
Z33862
Z33862
FGC30635
FGC30635
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies