Top » Catalog » SNPs » S11739

$18.00

S11739
[S11739]

S11739
hg38 Position: ChrY:8759205..8759205
Ancestral: T
Derived: G
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b1a2a1a1c1a1 (not listed)
Comments: Downstream S22069
Forward Primer: S11739v2_F CCTTGCAGGGGTTGTCCC
Reverse Primer: S11739v2_R ACTCAGCTTCATTCTAGCTGCAG
Reviews

Customers who bought this product also purchased
Mail Tracking
Mail Tracking
S18823
S18823
A10672
A10672
FGC15239
FGC15239
FGC15238
FGC15238
DF96
DF96
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies