Top » Catalog » SNPs » L317

$18.00

L317
[L317]

L317
hg38 Position: ChrY:15404196..15404196
Ancestral: T
Derived: C
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: J2a1 (not listed)
Comments: Below Z7700 > FGC9961 > Z33772
Forward Primer: L317_F GGGGTTAGGGTATGTTTGTGTG
Reverse Primer: L317_R TGATATTCCTGCCTACCTATTAGTGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies