Top » Catalog » SNPs » Z63

$18.00

Z63
[Z63]

Z63
hg38 Position: ChrY:12280783..12280783
Ancestral: C
Derived: T
Reference: http://dna-forums.org/
ISOGG Haplogroup: I1a3
Comments: Aka S243. parallel to Z58
Forward Primer: Z63_F GTGAGCCCACAAAAGGAGTG
Reverse Primer: Z63_R GCGACTGTGCCAGACTAACC
Reviews

Customers who bought this product also purchased
S10066
S10066
FGC15560
FGC15560
Y11205
Y11205
S10908
S10908
A14157
A14157
A14608
A14608
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies