Top » Catalog » SNPs » A508

$18.00

A508
[A508]

A508
hg38 Position: ChrY:17135301..17135301
Ancestral: C
Derived: T
Reference: Bruce Cockburn (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A508_F TTGTGCCCTTCCCAATTTAG
Reverse Primer: A508_R TGGATTTTGAGAACAGAGCAG
Reviews

Customers who bought this product also purchased
DYS454
DYS454
DYS570
DYS570
DYS390
DYS390
DYS607
DYS607
A13703
A13703
YSEQ-Alpha-Beta
YSEQ-Alpha-Beta
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies