Top » Catalog » SNPs » FGC10502

$18.00

FGC10502
[FGC10502]

FGC10502
HG19 Position: ChrY:23543344..23543344
Ancestral: ins
Derived: del
Reference: Full Genomes (2014)
ISOGG Haplogroup: J1a (not listed)
Comments: Downstream FGC10500 > CTS8308
Forward Primer: FGC10502_F AATGGAATTCTTTTACACAGAGAAATC
Reverse Primer: FGC10502_R CAAAGGAAGAAGAAGAAGAAAGC
Reviews

Customers who bought this product also purchased
FGC10500
FGC10500
DYF397
DYF397
FGC30416
FGC30416
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies