Top » Catalog » SNPs » FGC30416

$18.00

FGC30416
[FGC30416]

FGC30416
hg38 Position: ChrY:20980021..20980021
Ancestral: T
Derived: C
Reference: Full Genomes Corp (2015)
ISOGG Haplogroup: J1 (not listed)
Comments: Aka ZS5871 Downstream FGC10500
Forward Primer: FGC30416_F TCCCATGGAAAGAACACTGAG
Reverse Primer: FGC30416_R CGGAAGCCATCATCCTCTG
Reviews

Customers who bought this product also purchased
FGC68219
FGC68219
FGC9587
FGC9587
FGC30566
FGC30566
FGC9589
FGC9589
FGC9581
FGC9581
YSEQ-Alpha
YSEQ-Alpha
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies