Top » Catalog » SNPs » FGC30416

$17.50

FGC30416
[FGC30416]

FGC30416
HG19 Position: ChrY:23141907..23141907
Ancestral: T
Derived: C
Reference: Full Genomes Corp (2015)
ISOGG Haplogroup: J1 (not listed)
Comments: Aka ZS5871 Downstream FGC10500
Forward Primer: FGC30416_F TCCCATGGAAAGAACACTGAG
Reverse Primer: FGC30416_R CGGAAGCCATCATCCTCTG
Reviews

Customers who bought this product also purchased
YSEQ-Alpha
YSEQ-Alpha
L859
L859
FGC8703
FGC8703
FGC8712
FGC8712
FGC10500
FGC10500
FGC10502
FGC10502
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies