Top » Catalog » SNPs » FGC30416

$18.00

FGC30416
[FGC30416]

FGC30416
hg38 Position: ChrY:20980021..20980021
Ancestral: T
Derived: C
Reference: Full Genomes Corp (2015)
ISOGG Haplogroup: J1 (not listed)
Comments: Aka ZS5871 Downstream FGC10500
Forward Primer: FGC30416_F TCCCATGGAAAGAACACTGAG
Reverse Primer: FGC30416_R CGGAAGCCATCATCCTCTG
Reviews

Customers who bought this product also purchased
FGC68219
FGC68219
FGC9587
FGC9587
FGC30566
FGC30566
FGC9589
FGC9589
FGC9581
FGC9581
L859
L859
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies