Top » Catalog » SNPs » FGC15268

$19.00

FGC15268
[FGC15268]

FGC15268
hg38 Position: ChrY:3019813..3019813
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: FGC15268_F CTTGTAGAGAGAGAGAGGTAGGAGG
Reverse Primer: FGC15268_R GGGGTCCTTGGAAGATTTTTC
Reviews

Customers who bought this product also purchased
A10973
A10973
A730
A730
A731
A731
FGC15273
FGC15273
FGC15271
FGC15271
FGC15270
FGC15270
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies