Top » Catalog » SNPs » FGC9581

$19.00

FGC9581
[FGC9581]

FGC9581
hg38 Position: ChrY:11071927..11071927
Ancestral: G
Derived: T
Reference: Full Genomes (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: Downstream FGC10500
Forward Primer: FGC9581v2_F AACGACAACAACAACAAAAACC
Reverse Primer: FGC9581v2_R GCCCTATGTTTATGTCAGCTCC
Reviews

Customers who bought this product also purchased
ZS10833
ZS10833
BY49997
BY49997
FGC10493
FGC10493
FGC8712
FGC8712
FGC41038
FGC41038
FGC54257
FGC54257
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies