Top » Catalog » SNPs » FGC9581

$18.00

FGC9581
[FGC9581]

FGC9581
hg38 Position: ChrY:11071927..11071927
Ancestral: G
Derived: T
Reference: Full Genomes (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: Downstream FGC10500
Forward Primer: FGC9581v2_F AACGACAACAACAACAAAAACC
Reverse Primer: FGC9581v2_R GCCCTATGTTTATGTCAGCTCC
Reviews

Customers who bought this product also purchased
FGC10500
FGC10500
FGC8703
FGC8703
FGC65960
FGC65960
FGC65954
FGC65954
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies