Top » Catalog » SNPs » FGC15269

$18.00

FGC15269
[FGC15269]

FGC15269
hg38 Position: ChrY:8246645..8246645
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: FGC15269_F GGTCTCTGTATTATAGAACAGTGTTGG
Reverse Primer: FGC15269_R TCTTAGGGTAGAAACAATTGACCC
Reviews

Customers who bought this product also purchased
FGC45254
FGC45254
Z5018
Z5018
DNA Sample Kit
DNA Sample Kit
A684
A684
FGC15284
FGC15284
FGC15268
FGC15268
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies