Top » Catalog » SNPs » A8458

$19.00

A8458
[A8458]

A8458
hg38 Position: ChrY:12387335..12387335
Ancestral: A
Derived: C
Reference: Steve Fix (2015)
ISOGG Haplogroup: E1b (not listed)
Comments: Below Z5018 > A7136
Forward Primer: A8458_F GAAGGTTCATTACGTGATCCCA
Reverse Primer: A8458_R AAAAAGAAAATGGGGACTCACTG
Reviews

Customers who bought this product also purchased
Y83041
Y83041
BY5423
BY5423
A8555
A8555
BY5431
BY5431
BY5400
BY5400
E1b-A7136 Segregation Panel
E1b-A7136 Segregation Panel
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies