Top » Catalog » SNPs » A8458

$18.00

A8458
[A8458]

A8458
hg38 Position: ChrY:12387335..12387335
Ancestral: A
Derived: C
Reference: Steve Fix (2015)
ISOGG Haplogroup: E1b (not listed)
Comments: Below Z5018 > A7136
Forward Primer: A8458_F GAAGGTTCATTACGTGATCCCA
Reverse Primer: A8458_R AAAAAGAAAATGGGGACTCACTG
Reviews

Customers who bought this product also purchased
Y83041
Y83041
BY5423
BY5423
A8555
A8555
Y18675
Y18675
Y18360
Y18360
BY5431
BY5431
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies