Top » Catalog » SNPs » Z8425

$18.00

Z8425
[Z8425]

Z8425
hg38 Position: ChrY:10168409..10168409
Ancestral: G
Derived: A
Reference: Ray Banks (2015)
ISOGG Haplogroup: J2 (not listed)
Comments: approximate with Z1043
Forward Primer: Z8425_F GACTCTGTGTTAGAAAAAGTAATATGACTTATG
Reverse Primer: Z8425_R CCCCACAAGGAAGTTTTATCTC
Reviews

Customers who bought this product also purchased
J2b-M12 Panel
J2b-M12 Panel
Y105578
Y105578
A15071
A15071
Y30090
Y30090
Y26712
Y26712
Z1297
Z1297
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies