Top » Catalog » SNPs » Z8425

$18.00

Z8425
[Z8425]

Z8425
hg38 Position: ChrY:10168409..10168409
Ancestral: G
Derived: A
Reference: Ray Banks (2015)
ISOGG Haplogroup: J2 (not listed)
Comments: approximate with Z1043
Forward Primer: Z8425_F GACTCTGTGTTAGAAAAAGTAATATGACTTATG
Reverse Primer: Z8425_R CCCCACAAGGAAGTTTTATCTC
Reviews

Customers who bought this product also purchased
PH1553
PH1553
FGC62432
FGC62432
Y145905
Y145905
PH1080
PH1080
Y92225
Y92225
Z1297
Z1297
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies