Top » Catalog » SNPs » FGC15270

$18.00

FGC15270
[FGC15270]

FGC15270
hg38 Position: ChrY:14076196..14076196
Ancestral: C
Derived: A
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: FGC15270_F AGTAAGATGGGTTTGGCTTGG
Reverse Primer: FGC15270_R GAGGCATCTAGGTGTAGTTGCAG
Reviews

Customers who bought this product also purchased
A10244
A10244
A10245
A10245
A5395
A5395
A5392
A5392
DYS438
DYS438
CDY
CDY
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies